stri_trans_char: Translate Characters

Description

Translates Unicode code points in each input string.

Usage

stri_trans_char(str, pattern, replacement)

Arguments

str

character vector

pattern

a single character string providing code points to be translated

replacement

a single character string giving translated code points

Details

Vectorized over str and with respect to each code point in pattern and replacement.

If pattern and replacement consist of a different number of code points, then the extra code points in the longer of the two are ignored, with a warning.

If code points in a given pattern are not unique, the last corresponding replacement code point is used.

Time complexity for each string in str is O(stri_length(str)*stri_length(pattern)).

Value

Returns a character vector.

Examples

stri_trans_char('id.123', '.', '_')
stri_trans_char('babaab', 'ab', '01')
stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA')